ID: 1091792106_1091792111

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091792106 1091792111
Species Human (GRCh38) Human (GRCh38)
Location 12:3277852-3277874 12:3277887-3277909
Sequence CCTTTCTCCATCTGTGGGAAATT CCAGTGGACAAATGGCCCTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 327} {0: 1, 1: 0, 2: 2, 3: 6, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!