ID: 1091801262_1091801273

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1091801262 1091801273
Species Human (GRCh38) Human (GRCh38)
Location 12:3326195-3326217 12:3326236-3326258
Sequence CCTGCAGGCCCATCCGTGTCTGT TGAATTTTTTATGAAGTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!