ID: 1091806904_1091806913

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1091806904 1091806913
Species Human (GRCh38) Human (GRCh38)
Location 12:3363446-3363468 12:3363485-3363507
Sequence CCTACCTGGAAGCCGGCATGTAA GCTGCTGGTGTGAGGGATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!