|
Left Crispr |
Right Crispr |
| Crispr ID |
1091811868 |
1091811878 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:3406149-3406171
|
12:3406196-3406218
|
| Sequence |
CCTTTTGAAGCAATGGCTTGAGC |
GGATGGAGCAGCTGGGATTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 35, 2: 319, 3: 676, 4: 1224} |
{0: 1, 1: 4, 2: 156, 3: 563, 4: 1338} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|