ID: 1091811873_1091811888

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1091811873 1091811888
Species Human (GRCh38) Human (GRCh38)
Location 12:3406183-3406205 12:3406229-3406251
Sequence CCCTTTTAGCCAAGGATGGAGCA CTGGGGCTACACACAGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 144, 3: 803, 4: 1486} {0: 1, 1: 2, 2: 39, 3: 156, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!