ID: 1091811874_1091811886

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1091811874 1091811886
Species Human (GRCh38) Human (GRCh38)
Location 12:3406184-3406206 12:3406227-3406249
Sequence CCTTTTAGCCAAGGATGGAGCAG TTCTGGGGCTACACACAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 137, 3: 745, 4: 1448} {0: 1, 1: 0, 2: 12, 3: 68, 4: 402}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!