ID: 1091811874_1091811888

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091811874 1091811888
Species Human (GRCh38) Human (GRCh38)
Location 12:3406184-3406206 12:3406229-3406251
Sequence CCTTTTAGCCAAGGATGGAGCAG CTGGGGCTACACACAGCAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 137, 3: 745, 4: 1448} {0: 1, 1: 2, 2: 39, 3: 156, 4: 624}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!