ID: 1091811877_1091811885

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1091811877 1091811885
Species Human (GRCh38) Human (GRCh38)
Location 12:3406192-3406214 12:3406226-3406248
Sequence CCAAGGATGGAGCAGCTGGGATT GTTCTGGGGCTACACACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 150, 4: 669} {0: 1, 1: 0, 2: 12, 3: 62, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!