ID: 1091812563_1091812571

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1091812563 1091812571
Species Human (GRCh38) Human (GRCh38)
Location 12:3411657-3411679 12:3411709-3411731
Sequence CCATTGGGAGATAACTAGAATTA GGGCCCCATGATGAAACTGGTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 43, 3: 207, 4: 764} {0: 1, 1: 1, 2: 8, 3: 54, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!