ID: 1091833442_1091833450

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1091833442 1091833450
Species Human (GRCh38) Human (GRCh38)
Location 12:3567372-3567394 12:3567423-3567445
Sequence CCCATGCTCTCATCAAAATATCA CACCCATTTGGTATTGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 259} {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!