ID: 1091838338_1091838346

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1091838338 1091838346
Species Human (GRCh38) Human (GRCh38)
Location 12:3601774-3601796 12:3601799-3601821
Sequence CCTCTGGCAATGTGGTTTCTGGG CTCTGTGAGGGGAGAAGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 183} {0: 1, 1: 1, 2: 3, 3: 37, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!