ID: 1091849277_1091849288

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091849277 1091849288
Species Human (GRCh38) Human (GRCh38)
Location 12:3682191-3682213 12:3682236-3682258
Sequence CCTTCCTCCTTCCCCACCCTCAG CAAAATGTGGTCTCTCGCACTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 24, 3: 271, 4: 2352} {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!