ID: 1091857857_1091857869

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1091857857 1091857869
Species Human (GRCh38) Human (GRCh38)
Location 12:3753407-3753429 12:3753448-3753470
Sequence CCCGAAAACCCGGCAGCAGCCCG CCTCTGGGAGCAGAAACTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 100} {0: 1, 1: 0, 2: 0, 3: 13, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!