ID: 1091858244_1091858248

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1091858244 1091858248
Species Human (GRCh38) Human (GRCh38)
Location 12:3756107-3756129 12:3756137-3756159
Sequence CCCTAAGAGGCCACTGCTAGGTC CACCAGGAAATGTGTGTCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79} {0: 1, 1: 0, 2: 2, 3: 36, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!