ID: 1091864589_1091864593

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1091864589 1091864593
Species Human (GRCh38) Human (GRCh38)
Location 12:3820496-3820518 12:3820522-3820544
Sequence CCAGAGTAAAACTGTTCCCATTG TTCTTAGTATAAAATGTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 356} {0: 1, 1: 0, 2: 2, 3: 31, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!