ID: 1091879793_1091879804

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1091879793 1091879804
Species Human (GRCh38) Human (GRCh38)
Location 12:3967859-3967881 12:3967912-3967934
Sequence CCTTTGCCCCAGCATTCACCAGT CAGGCTCTACCTGGGTGTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 42, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!