|
Left Crispr |
Right Crispr |
| Crispr ID |
1091936069 |
1091936072 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:4435378-4435400
|
12:4435401-4435423
|
| Sequence |
CCTGCTCCTTCTGAGAATCTAAC |
TAATGCCTGATGATCTGAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 13, 2: 59, 3: 95, 4: 210} |
{0: 847, 1: 1053, 2: 687, 3: 346, 4: 231} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|