ID: 1091947061_1091947062

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1091947061 1091947062
Species Human (GRCh38) Human (GRCh38)
Location 12:4556091-4556113 12:4556105-4556127
Sequence CCTTCTCTGAGAGTGGGGATAGT GGGGATAGTAATATCTGTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137} {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!