ID: 1091970774_1091970776

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1091970774 1091970776
Species Human (GRCh38) Human (GRCh38)
Location 12:4785093-4785115 12:4785112-4785134
Sequence CCCTAGCACAGCTCTCTGCACAT ACATAGATGTCCAATTAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 225} {0: 1, 1: 0, 2: 1, 3: 5, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!