ID: 1091974010_1091974023

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1091974010 1091974023
Species Human (GRCh38) Human (GRCh38)
Location 12:4810500-4810522 12:4810543-4810565
Sequence CCAGCCCTTCCAGCGCCAGGTGT GAGAGCTCTGGGCCGGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 26, 4: 298} {0: 1, 1: 0, 2: 1, 3: 16, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!