ID: 1092002720_1092002732

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1092002720 1092002732
Species Human (GRCh38) Human (GRCh38)
Location 12:5045000-5045022 12:5045024-5045046
Sequence CCTCCGGCGCCCCACCAGCCTCC GCGCCCGCCCCTGGGGCCAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 798} {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!