ID: 1092002724_1092002732

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1092002724 1092002732
Species Human (GRCh38) Human (GRCh38)
Location 12:5045011-5045033 12:5045024-5045046
Sequence CCACCAGCCTCCCGCGCCCGCCC GCGCCCGCCCCTGGGGCCAACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 142, 4: 1012} {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!