ID: 1092050724_1092050731

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1092050724 1092050731
Species Human (GRCh38) Human (GRCh38)
Location 12:5467994-5468016 12:5468011-5468033
Sequence CCCCCCACATTTTCCCTCTGATG CTGATGAGATTTCCTCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 447} {0: 1, 1: 0, 2: 0, 3: 18, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!