ID: 1092052248_1092052256

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1092052248 1092052256
Species Human (GRCh38) Human (GRCh38)
Location 12:5480253-5480275 12:5480296-5480318
Sequence CCAGAATGCCTGTTTGCATTCGC GGGTGGAAAAACAATCCCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74} {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!