ID: 1092059242_1092059250

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1092059242 1092059250
Species Human (GRCh38) Human (GRCh38)
Location 12:5535102-5535124 12:5535150-5535172
Sequence CCACCTTTGGGTAGCTCTGGCTC CTGTAGCTTTAGGAGAGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 178} {0: 1, 1: 0, 2: 3, 3: 30, 4: 445}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!