ID: 1092068776_1092068781

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1092068776 1092068781
Species Human (GRCh38) Human (GRCh38)
Location 12:5615531-5615553 12:5615563-5615585
Sequence CCTTCCTCCTCTTGTCTACTCAA TCACACCGCCCTCCTCAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 385} {0: 1, 1: 0, 2: 3, 3: 11, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!