ID: 1092084439_1092084449

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1092084439 1092084449
Species Human (GRCh38) Human (GRCh38)
Location 12:5744125-5744147 12:5744174-5744196
Sequence CCATATAAGCAAGCCTGGTGATG ATAGAGAAGAAGACGGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86} {0: 1, 1: 0, 2: 2, 3: 22, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!