ID: 1092119544_1092119554

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1092119544 1092119554
Species Human (GRCh38) Human (GRCh38)
Location 12:6034427-6034449 12:6034478-6034500
Sequence CCCACACCAATCCTCAACAACAA CCAGGTGAGCAGAGGGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 231} {0: 1, 1: 0, 2: 2, 3: 48, 4: 504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!