ID: 1092125734_1092125742

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1092125734 1092125742
Species Human (GRCh38) Human (GRCh38)
Location 12:6073915-6073937 12:6073946-6073968
Sequence CCCTTAGATGAACATCTTCCATC CCCTTACCAAGACCCATCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167} {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!