ID: 1092125769_1092125772

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1092125769 1092125772
Species Human (GRCh38) Human (GRCh38)
Location 12:6074050-6074072 12:6074071-6074093
Sequence CCTTTCAGAGTGACACCAAACTC TCCTCTAGGCTCAAAACAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132} {0: 1, 1: 0, 2: 3, 3: 8, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!