ID: 1092126544_1092126550

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1092126544 1092126550
Species Human (GRCh38) Human (GRCh38)
Location 12:6078770-6078792 12:6078789-6078811
Sequence CCCTCCCCTCTCAGAGCCGTGAC TGACCAGACAGAGCCCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 234} {0: 1, 1: 0, 2: 0, 3: 28, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!