ID: 1092128991_1092129000

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1092128991 1092129000
Species Human (GRCh38) Human (GRCh38)
Location 12:6095445-6095467 12:6095478-6095500
Sequence CCAGTCCACACCCACCTTCTGCA GGAGATGTTGCATGAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 377} {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!