ID: 1092143794_1092143799

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1092143794 1092143799
Species Human (GRCh38) Human (GRCh38)
Location 12:6201061-6201083 12:6201077-6201099
Sequence CCAAGAGCGGCTCTCACTTTTAC CTTTTACGCAGGAGCGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 76} {0: 1, 1: 0, 2: 0, 3: 1, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!