ID: 1092160545_1092160552

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1092160545 1092160552
Species Human (GRCh38) Human (GRCh38)
Location 12:6313131-6313153 12:6313156-6313178
Sequence CCACTCCCAGCTGGATGGGATGC GCTGCACGCCCCTGGGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 237} {0: 1, 1: 0, 2: 2, 3: 22, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!