ID: 1092168318_1092168325

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1092168318 1092168325
Species Human (GRCh38) Human (GRCh38)
Location 12:6356830-6356852 12:6356872-6356894
Sequence CCAGTGAGCAGCAGAGGAGGACT GGCTGGCCAGAGATAAAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 222} {0: 1, 1: 0, 2: 1, 3: 34, 4: 373}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!