ID: 1092170928_1092170933

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1092170928 1092170933
Species Human (GRCh38) Human (GRCh38)
Location 12:6373776-6373798 12:6373801-6373823
Sequence CCTGACCCATTCTCCTTGTTCTG AGGCCCCTGCCCCCAGCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 302} {0: 1, 1: 0, 2: 5, 3: 83, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!