ID: 1092171711_1092171715

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1092171711 1092171715
Species Human (GRCh38) Human (GRCh38)
Location 12:6377502-6377524 12:6377517-6377539
Sequence CCGGGAAGGCCTCCCTCACTCCC TCACTCCCACACAGAGCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 109, 4: 803} {0: 1, 1: 0, 2: 0, 3: 21, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!