ID: 1092173249_1092173261

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1092173249 1092173261
Species Human (GRCh38) Human (GRCh38)
Location 12:6386097-6386119 12:6386141-6386163
Sequence CCCCTGCAAGGCCGGGCACTTCC CCCGCTGCCAGCCCCACACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 165} {0: 1, 1: 0, 2: 5, 3: 41, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!