|
Left Crispr |
Right Crispr |
| Crispr ID |
1092185505 |
1092185518 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:6475683-6475705
|
12:6475730-6475752
|
| Sequence |
CCTCACTTCTCAGACAGGGTGGC |
TCTCAGATGGGGCAGCTGCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 17, 1: 445, 2: 4055, 3: 4443, 4: 5423} |
{0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|