ID: 1092187830_1092187837

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1092187830 1092187837
Species Human (GRCh38) Human (GRCh38)
Location 12:6493937-6493959 12:6493983-6494005
Sequence CCGTCCTGCAGCCGTTGAGATTT CCGCGCGTTGCCAGACTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 104} {0: 1, 1: 0, 2: 1, 3: 1, 4: 21}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!