ID: 1092191903_1092191907

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1092191903 1092191907
Species Human (GRCh38) Human (GRCh38)
Location 12:6527355-6527377 12:6527369-6527391
Sequence CCTTTTCCATCAGCTTCCATTGC TTCCATTGCTGGCCTGGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 299} {0: 1, 1: 0, 2: 1, 3: 26, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!