ID: 1092193715_1092193727

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1092193715 1092193727
Species Human (GRCh38) Human (GRCh38)
Location 12:6536897-6536919 12:6536922-6536944
Sequence CCATCTCCCCCCCACCCCCATAG GAGATCCCTCCAAAATCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 10, 3: 127, 4: 1297} {0: 2, 1: 6, 2: 12, 3: 16, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!