ID: 1092194310_1092194314

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1092194310 1092194314
Species Human (GRCh38) Human (GRCh38)
Location 12:6540182-6540204 12:6540219-6540241
Sequence CCGCAATCGCTCTGGCAGCATTT TAGCAGACACCCACGCGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 83} {0: 1, 1: 0, 2: 1, 3: 2, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!