ID: 1092197070_1092197087

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1092197070 1092197087
Species Human (GRCh38) Human (GRCh38)
Location 12:6555929-6555951 12:6555978-6556000
Sequence CCGGCGAAGTGGTCGCCTCCCAG CCTGCTGCTCCTGCTGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68} {0: 1, 1: 1, 2: 29, 3: 196, 4: 1049}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!