ID: 1092204695_1092204700

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1092204695 1092204700
Species Human (GRCh38) Human (GRCh38)
Location 12:6607586-6607608 12:6607614-6607636
Sequence CCCTTCGCAGCGGGCGCGCGCGC CTGGGCAACCGCCCACCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 61} {0: 1, 1: 0, 2: 3, 3: 17, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!