ID: 1092216806_1092216810

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1092216806 1092216810
Species Human (GRCh38) Human (GRCh38)
Location 12:6689194-6689216 12:6689232-6689254
Sequence CCAGGAAGGGGCGAGGGAGGGGA AGCGCGCGGGCACGCACTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 78, 4: 657} {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!