ID: 1092217293_1092217296

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1092217293 1092217296
Species Human (GRCh38) Human (GRCh38)
Location 12:6692446-6692468 12:6692482-6692504
Sequence CCTGTGGGGAAAGAAGGAAAGGT TATCCCACCCTCCTTGGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 359} {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!