ID: 1092218823_1092218836

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1092218823 1092218836
Species Human (GRCh38) Human (GRCh38)
Location 12:6699812-6699834 12:6699854-6699876
Sequence CCCCAAATGTAAAGGGATGTGGA ATGGGGGCATGGTGGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 187} {0: 1, 1: 0, 2: 15, 3: 85, 4: 837}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!