|
Left Crispr |
Right Crispr |
| Crispr ID |
1092223834 |
1092223843 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:6733528-6733550
|
12:6733568-6733590
|
| Sequence |
CCTCCGTCTCCTGGGTTGAAGTG |
TCCCGAGTAGCGGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 484, 2: 9491, 3: 42040, 4: 93262} |
{0: 121, 1: 45308, 2: 209287, 3: 255544, 4: 186118} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|