ID: 1092231794_1092231799

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1092231794 1092231799
Species Human (GRCh38) Human (GRCh38)
Location 12:6779884-6779906 12:6779918-6779940
Sequence CCATACAGGAGAACAAAATATTG GTGAGTGGGAGTGAAACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 406} {0: 1, 1: 0, 2: 0, 3: 33, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!